Top K Elements

 The top k elements pattern is an important technique in coding that helps us efficiently find a specific number of elements, known as  k, from a set of data. This is particularly useful when we’re tasked with identifying the largest, smallest, or most/least frequent elements within an unsorted collection.

Which data structure can we use to solve such problems?

A heap is the best data structure to keep track of the smallest or largest k elements. With this pattern, we either use a max heap or a min heap to find the smallest or largest k elements, respectively, because they allow us to efficiently maintain a collection of elements ordered in a way that gives us quick access to the smallest (min heap) or largest (max heap) element.


Algorithm


Max Heap => Smallest k elements

Min Heap => Largest k elements


Top 3 largest numbers



Comments

Post a Comment

Popular posts from this blog

1. Repeated DNA Sequences

Image
 T he  DNA sequence  is composed of a series of nucleotides abbreviated as  'A' ,  'C' ,  'G' , and  'T' For example,  "ACGAATTCCG"  is a  DNA sequence . When studying  DNA , it is useful to identify repeated sequences within the DNA. Given a string  s  that represents a  DNA sequence , return all the  10 -letter-long  sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in  any order .   Example 1: Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" Output: ["AAAAACCCCC","CCCCCAAAAA"] Ex ample 2: Input: s = "AAAAAAAAAAAAA" Output: ["AAAAAAAAAA"]
Read more

1. Valid palindrome

Image
Algorithm: Initialize two pointers, left at the start and right at the end of the string. Iterate until the left pointer is before the right pointer, skipping non-alphanumeric characters for both pointers. Compare characters positioned at the left and right pointers in lowercase; if they differ, return FALSE. Move left forward and right backward to check the next pair of characters. If the traversal completes without mismatches, return TRUE indicating the string is a palindrome. valid palindrome
Read more