1. Repeated DNA Sequences

 The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'


  • For example, "ACGAATTCCG" is a DNA sequence.

When studying DNA, it is useful to identify repeated sequences within the DNA.

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

 

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]
Solution Overview
  1. Fixed Sliding Window: You iterate through the DNA string with a window of fixed size . This ensures you examine every possible 10-letter substring.
  2. Hash Map for Counting: A hash map (or dictionary) is used to keep track of the frequency of each 10-letter substring encountered.
  3. Result Collection: A list or set is used to store the repeated sequences.

solution overview


code


Comments

Post a Comment

Popular posts from this blog

Top K Elements

Image
  The  top k elements  pattern is an important technique in coding that helps us efficiently find a specific number of elements, known as  k, from a set of data. This is particularly useful when we’re tasked with identifying the largest, smallest, or most/least frequent elements within an unsorted collection. Which data structure can we use to solve such problems? A heap is the best data structure to keep track of the smallest or largest k  elements. With this pattern, we either use a max heap or a min heap to find the smallest or largest k elements, respectively, because they allow us to efficiently maintain a collection of elements ordered in a way that gives us quick access to the smallest (min heap) or largest (max heap) element. Algorithm Max Heap => Smallest k elements Min Heap => Largest k elements Top 3 largest numbers
Read more

1. Valid palindrome

Image
Algorithm: Initialize two pointers, left at the start and right at the end of the string. Iterate until the left pointer is before the right pointer, skipping non-alphanumeric characters for both pointers. Compare characters positioned at the left and right pointers in lowercase; if they differ, return FALSE. Move left forward and right backward to check the next pair of characters. If the traversal completes without mismatches, return TRUE indicating the string is a palindrome. valid palindrome
Read more